Data Archive
TaqMan RT-PCR primers and probes
Table 1. List of real-time RT-PCR primer and probe sets from Applied Biosystems.
Gene | Company | Hs number |
|---|---|---|
PDK11 |
Applied Biosystems |
Hs01561850_m1 |
LDHA |
Applied Biosystems |
Hs00855332_g1 |
TPI1 |
Applied Biosystems |
Hs01593134_gH |
B2M |
Applied Biosystems |
Hs00984230_m1 |
1The probe for each gene was labeled with a reporter fluorescent dye, FAM (6-carboxy-fluorescein), on the 5' nucleotide and a quenching dye, minor groove binder (MGB), on the 3' nucleotide.
Table 2. List of real-time RT-PCR primers and probe from Integrated DNA Technologies.
Gene | Company | GeneBank | Forward Primer | Reverse Primer | Probe1 |
|---|---|---|---|---|---|
ALDOC |
Integrated DNA Technologies |
AY893600.1 |
TGCCTATTGTGGAACCTGAAATA |
CTTGTACACAGCAGCCAAGA |
TGATGGAGACCACGACCTCAAACG |
1The probe was labeled with FAM on the 5' nucleotide and the quenching dye Iowa Black on the 3' nucleotide.